Ttc11/fis1
WebFis1, a 17KDa integral membrane protein, is a novel member of mitochondrial fission machinery. It consists of a central leucine-zipper domain, a coiled-coil region, a tetratricopeptide repeat domain and a C-terminal transmembrane domain. It is a human orthologue of Fis1p (S.cerevisiae) and is localized in the outer mitochondrial membrane. WebAnti-FIS1 Mouse mAb (1G9) liquid, clone 1G9, Calbiochem®; Synonyms: Anti-TTC11, Anti-Fission 1 Homolog; find Sigma-Aldrich-AP1165 MSDS, related peer-reviewed papers, technical documents, similar products & more at Sigma-Aldrich
Ttc11/fis1
Did you know?
WebGet better batch-to-batch reproducibility with a recombinant antibody. Anti-TTC11/FIS1 antibody [EPR8412] (ab156865) Research with confidence – consistent and reproducible … WebPrimePCR™ PreAmp for SYBR® Green Assay: FIS1, Human Reaction: 400 reactions Gene-specific PCR ... TTC11 is a component of a mitochondrial complex that promotes mitochondrial fission (James et al. 2003 [PubMed 12783892]).[supplied by …
WebRabbit Monoclonal FIS1 antibody [GT1188]. Validated in WB, ICC/IF, IHC-P, IP. Tested in Human, Mouse, Rat. United States (US) Country ... TTC11 is a component of a mitochondrial complex that promotes mitochondrial fission (James et al., 2003 [PubMed 12783892]).[supplied by OMIM, Mar 2008] WebAnti-TTC11/FIS1 antibody [EPR8412] (ab156865) Research with confidence – consistent and reproducible results with every batch. Long-term and scalable supply – powered by …
Web(ab156865) Anti-TTC11/FIS1 antibody [EPR8412] - Abcam - CiteAb. 16 citations – A rabbit monoclonal antibody, raised against Mitochondrial fission 1 protein (Human), supplied by Abcam. ... FIS1 homolog, Tetratricopeptide repeat protein 11, FIS1_HUMAN. UniProt Code History Q9BTP3, Q9Y3D6. Gene Synonyms FIS1, TTC11, CGI-135. WebAll lanes : Anti-TTC11/FIS1 antibody [EPR8412] (ab156865) at 1/10000 dilution (Purified) Lane 1 : Jurkat (Human T cell leukemia T lymphocyte) whole cell lysate Lane 2 : Raji …
WebBrowse FIS1 products, learn FIS1 Information And Facts common name: TTC11. Involved from the fragmentation of the mitochondrial system and its perinuclear clustering. Plays a …
WebGene_name： FIS1 TTC11 CGI-135 Protein_name： Mitochondrial fission 1 protein (FIS1 homolog) ... P84817 Immunogen： Synthesized peptide derived from human FIS1 Specificity： This antibody detects endogenous levels of human FIS1 Formulation： Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. Source： Rabbit … readiness insight login amentumWebPrimePCR™ PreAmp for SYBR® Green Assay: FIS1, Human Reaction: 400 reactions Gene-specific PCR ... TTC11 is a component of a mitochondrial complex that promotes … readiness indicatorWebFis1, a 17KDa integral membrane protein, is a novel member of mitochondrial fission machinery. It consists of a central leucine-zipper domain, a coiled-coil region, a … readiness indicator scottish waterWebFIS1 (a.k.a. CGI-135, TTC11) Cloning Information Cloning method Gibson Cloning 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG 3′ sequencing primer ATAGCGTAAAAGGAGCAACA (Common Sequencing Primers) Terms and Licenses. Academic/Nonprofit Terms. UBMTA; Institut Pasteur Label License for ... how to strawberry seedsWebCGI135; FIS1; hFis1; TTC 11; Immunogen. A synthesized peptide derived from human TTC11. Storage. Rabbit IgG in phosphate buffered saline , pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Store at +4°C short term. Store at -20°C long term. Avoid freeze / thaw cycle. Purification. how to streak in tube buttWebThis product is manufactured by BioVision, an Abcam company and was previously called 3491R Fis1 Polyclonal Antibody. The Life Science industry has been in the grips of a … readiness integration organizationWebAll lanes : Anti-TTC11/FIS1 antibody - N-terminal (ab189846) at 1/500 dilution Lane 1 : 293T cell line extract Lane 2 : HepG2 cell line extract Lane 3 : A549 cell line extract Lane 4 : … readiness is a vaginal sensation of wanting